Abstract

Background: Methicillin Resistant Staphylococcus aureus and severe antimicrobial resistance is worsened in HIV positive patients, driven by the presence of drug resistance traits. This study aimed to determine the prevalence of MRSA, antibiotic susceptibility, source of infection and the distribution of drug resistance genes amongst HIV positive and HIV negative participants in Fako-Cameroon. Methods: Urine and nasal samples were cultured on CLED and MSA agar respectively following standard procedures. The clinical isolates were characterized biochemically and comfirmed by nuc gene detection of S. aureus. Antimicrobial susceptibility with selected locally prescribed antibiotics was done using the Kirby Bauer disc diffusion technique. Drug resistance genes (vanA, mecA, ermA, sul3 and ermC) were determined using PCR amplification. Data was analyzed using Microsoft Excel 2016 and SPSS version 25; Chi square was set at P ≤ 0.05. Results: The overall prevalence of MRSA was 28.8%. MRSA was higher (P = 0.0001) in HIV positive patients (19.4%) than in HIV negative individuals (9.4%). Amongst HIV positive and HIV negative participants, high sensitivity of urogenital S. aureus was observed amongst Aminoglycosides [Amikacin (26.3% vs 52.9%)] and Nitrofurans [Nitrofurantoin (25.2% vs 53.1%)]. Resistance was seen against Ciprofloxacin [39.5% vs 41.2%] in HIV positive and HIV negative participants respectively. MAR index of urogenital S. aureus was higher amongst HIV positive patients (0.9) compared to HIV negative individuals (0.7). Majority (38.0%) of S. aureus clinical isolates cultured from the urine of HIV positive patients were not identical to isolates from the nostrils of the same patients. The overall detection rate of drug resistance genes were distributed as follows; vanA (30.8%), ermA (29.6%), mecA (28.6%), sul3 (21.6%) and ermC (18.0%). Conclusion: Methicillin resistant Staphylococcus aureus is more common amongst HIV positive patients, with the clinical isolates being, more resistant to commonly prescribed antimicrobial agents. The clinical isolates causing urinary tract infections in HIV positive patients are usually not from the normal flora (the nostrils).

Keywords

MRSA, Drug Resistance Genes, Cameroon

Share and Cite:

FacebookTwitterLinkedInSina Weibo分享

Anumbondem, A. , Thumamo, B. , Enjong, B. , Elua, N. , Ghogomu, S. and Nyasa, R. (2025) Drug Resistance Genes and Source of Methicillin Resistant Staphylococcus aureus Strains amongst HIV Patients in Fako Division of Cameroon: A Case-Control Study. World Journal of AIDS, 15, 65-90. doi: 10.4236/wja.2025.153004.

1. Introduction

Microorganisms such as Staphylococcus aureus are disease causative agents, with the ability to cause infections in different human body sites; remarkably the anterior nares, skin, armpit, vagina, upper respiratory tracts, sometimes serving as a reservoir for most opportunistic infections [1]. S. aureus have been reported as a urogenital pathogen; which presents doubt as to whether the bacteria that infects the urinary tract actually originate from the nasal tract as a normal flora. Increase in MRSA have prevailed globally due to frequent exposure of S. aureus bacteria isolates to commonly used antibiotics. MRSA is one of the abundant pathogen of human existence that colonizes patients both within the hospitals and around the environments [2]. However, S. aureus isolated from different body parts often possess different antimicrobial resistance profiles [3]. This is worsened in HIV positive patients with a compromised immune system, enhancing bacterial susceptibility and heightened antimicrobial resistance; which may further complicate treatment. There is a growing concern of S. aureus antimicrobial resistance, especially with the activities of Methicillin resistant Staphylococcus aureus (MRSA) [4]. S. aureus antimicrobial susceptibility has been extensively studied globally; a study reported in Iran observed varying resistance to different antibiotics; Erythromycin (70%), Clindamycin (45%) and 100% sensitivity to Vancomycin, with ermA gene (5%) and ermC gene (10%) being detected [5]. Other studies have accessed S. aureus genotypic variants in Africa. A study conducted in Ethiopia reported that mecA gene was detected in 27.5% of S. aureus bacteria isolates [6]. In another study carried out in Southwestern Nigeria, S. aureus resistance was observed respectively between HIV positive and HIV negative participants as follows; Ampicillin (93.3% vs 84.0%), Ceftriaxone (73.3% vs 32.0%), Augmentin (60.0% vs 16.0%) and Bactrim (66.7% vs 80.0%) [7]. In a study reported by Morgan et al., in 2023, nasal carriage S. aureus isolates were resistant to Ampicillin (100%), Cefixime (81.82%), while urogenital S. aureus was resistant to Ampicillin (100%) and Cefixime (95%) [3], in Buea-Cameroon. Most MRSA bacteria isolates have been reported to be resistant to Penicillins and Cephalosporins [8]. However, Vancomycin stands as one of the most sensitive antibiotics for MRSA treatment amidst new antibiotics [9]. Though Vancomycin resistance has been reported globally; Africa (16%), Asia (5%) and South America (4%), MRSA should be considered a top priority pathogen because of its public health importance. Resistance to methicillin is due to beta lactamase production by S. aureus isolates, which help the organism to modify penicillin-binding proteins (PBPs), reducing the antibiotic’s ability to bind and kill the bacterium; enhancing resistance to Penicillins, Beta lactams and Cephalosporins. S. aureus isolates that are resistant to Macrolides (Erythromycin, Clarithromycin) and Lincosamides (Clindamycin) actually make use of the Methylase (erm) gene which help to methylate 50S ribosomal binding sites, leading to antimicrobial resistance [10].

However, S. aureus isolates from the urinary tract may share resistance traits with isolates from the nostrils, although that relationship remains unclear. This stands a great knowledge gap with direct implications on treatment outcomes and preventive measures from S. aureus infected patients. Few studies in HIV endemic areas including Fako-Cameroon have reported the antimicrobial resistance profiles and drug resistance gene profiles in S. aureus isolates; isolated from the urinary tract and nasal tracts of HIV positive and HIV negative individuals. Providing this data will therefore strengthen clinical decision (empirical therapeutic guidance), Antimicrobial surveillance, and enhance decolonization strategies in HIV patients. We hypothesize that urogenital S. aureus isolates will exhibit higher resistance to antimicrobials due to selective pressure in HIV positive patients. This study aimed to determine the prevalence of MRSA, antibiotic susceptibility, source of infection and the distribution of drug resistance genes amongst HIV positive and HIV negative participants in Fako-Cameroon

2. Materials and Methods

2.1. Study Area and Study Population

Five subdivisions (Buea, Tiko, Limbe, Muyuka and Idenau) make up the Fako division, where the study was conducted. Different levels of health facilities are found in Fako division; which are both private owned and public owned hospitals. Sub-divisional health centres provide health services in rural areas, standing as the smallest unit of health facilities in Cameroon. This is followed by the district hospitals, which are located in the urban areas; towns and provide health care to the population. Referral hospitals named Regional hospitals are located in different regions and receive referral cases from the district hospitals and health centres. Fako division is cosmopolitan, made up of civil servants, traders, farmers and students; comprised of the dry season (from November to February) and the rainy season (from March to October).

2.2. Study Design and Sampling of Study Participants

This study was a hospital—based case-control study and with non-matched variables. It was conducted from March 2024 to April 2025. The cases group comprised of people aged 18 years and above, living with HIV and who were already on treatment for at least three months. For the control group, they were individuals who were not living with HIV and were 18 years and above. All persons who had not taken antibiotics for more than three weeks who willingly gave their consent were included in the study. Participants who were bed-ridden, and or pregnant women were excluded from the study. Study participants were recruited from health facilities in Fako division by convenience and purposeful sampling methods. HIV positive patients were purposively selected based on predefined inclusion criteria such as confirmed HIV status. This method ensured that only individuals with the characteristics relevant to the study’s objective were included. All the HIV positive patients were recruited following the same inclusion criteria. Consecutively, HIV negative controls who met with the inclusion criteria and presented at the same health care facilities during the study period were recruited. This method ensured that the sample represented the typical HIV negative population accessing care during the study period.

 

Figure 1. Summary of the research protocol.

The Buea regional hospital is the only referral health facility with an accredited laboratory in the region. Other facilities were selected because they have been empowered to provide health services to HIV patients in the sud-divisions of Fako. The study participants were included in the study by consecutive sampling, where urine and nasal samples were collected. Both the symptomatic and asymptomatic population gave their urine and nasal samples; following the inclusion and exclusion criteria of the study. Demographic data was obtained using well-structured questionnaires; urine, nasal and blood samples were collected from 250 HIV positive and 250 HIV negative individuals. Urine and nasal swabs were used for culture and isolation of S. aureus and determination drug resistance genes while blood samples were used to determine the HIV status of study participants (Figure 1).

2.3. Bias

In order to avoid measurement bias, laboratory protocols, questionnaires and all procedures were carried out on both HIV positive and HIV negative participants. As for selection bias, we used the same inclusion exclusion criteria for both HIV positive and HIV negative individuals. Participants were recruited from the same health institutions and on the same day.

2.4. Sample Size Calculation

Sample size was calculated using the formula proposed by Kasiulevicius [11];

(N) = r + 1(P*) (1 – P*)(Zβ + Zα/2)2/1 (D)2.

Where, r = Ration of controls to cases to be recruited in the study, Zβ = Standard normal variate for power 80%; 0.84, Zα/2 = Standard normal variate for a level of significance at P < 0.05, P* = D = (p1 – p2) = Difference in proportions expected based on previous studies, P1 = Pre-study estimate of the proportion of bacteria in HIV patients = 48% [7]. P2 = Pre-study estimate of the proportion of bacteria in Non-HIV patients = 52% [7],

D = minimum expected difference = |48% − 52%| = −4%

P* = (0.70 + 0.51)/2 = 0.6

Numerical computations

N = 1 + 1(0.6)(1 – 0.6)(0.8 + 0.05)2/1 (−0.04)2, N = 237

A minimum of 237 participants were to be recruited for each group but we recruited 250.

2.5. Ethical Consideration

Study participants willingly gave their informed consent to participate in the study; they were properly educated using the best languages well understood by the participants; on the benefits of the research as participants. Ethical clearance was obtained from the institutional review board of the faculty of Health Sciences, University of Buea (2024/2057-03/UB/SG/IRB/FHS) and administrative authorization was obtained from the Regional delegation of public health for the South West region of Cameroon (RII/MINSANTE/SWR/RDPH/PS/129/161).

2.6. Data and Sample Collection

Socio-demographic data; gender, age, occupation, Educational status and marital status) were collected with the help of well-structured questionnaires. Mid-stream urine samples were collected in sterile wide-mouth leaked proof cups. Nasal samples were collected using sterile cotton tipped swabs dipped in sterile physiological saline. Two milliliters of whole blood were collected into EDTA tubes; for plasma, extraction and confirmation of HIV status of participants using determine (Abbott) rapid test strip. Samples were collected in different days and transported to the Buea regional hospital laboratory where urine and nasal samples were inoculated and incubated within two hours of sample collection.

3. Laboratory Analysis

3.1. Bacteriological Culture of Samples and Antibiotic Susceptibility Testing of Clinical Isolates

Two culture media were used for the primary isolation of bacteria isolates. Urine samples were seeded using a sterile calibrated wire loop (0.01 ml) on Cysteine lysine electrolyte deficiency agar (Titan Biotech lmt India). Nasal samples were inoculated on Manitol salt agar (Liofilchem Srl Italy) and the plates were incubated at 37˚C for 24 hours aerobically. Bacteria growth on CLED agar with golden yellow, circular shaped and 1 – 3 mm in diameter were S. aureus presumptive isolates, which where subcultured on MSA agar for 24 hours. All bacteria isolates on MSA agar with raised colonies and yellow coloration of the MSA media were further incubated anaerobically for 24 hours at 37˚C. Colonies, which were large, round, smooth and golden-yellow, were gram stained and observed microscopically for purple-clustered cocci organisms. S. aureus presumptive isolates were biochemically characterized using the catalase, coagulase, Novobiocin and DNASE tests; as reported in other studies [12]. Bacteria isolates were considered S. aureus presumptive isolates if the catalase test, coagulate test, Novobiocin and or DNase tests were positive. Antibiotic susceptibility testing of S. aureus clinical isolates was done using the disk-diffusion technique on Mueller Hinton agar plates; following standards operating procedures as recommended by the Clinical Laboratory Standard Institute [13]. The antibiotics used in this study included Amoxicillin (10 µg), Augmentin (30 µg), Ceftriaxone (30 µg), Amikacin (30 µg), Ciprofloxacine (5 µg), Erythromycin (15 µg), Clindamycin (10 µg), Chloramphenicol (30 µg), Bactrim (30 µg), Vancomycin (10 µg) and Nitrofurantoin (30 µg). Although Nitrofurantoin is not a first-line treatment for systemic S. aureus infections due to poor tissue penetration and limited efficacy, it is occasionally used for uncomplicated urinary tract infections (UTIs) caused by S. aureus in our clinical settings. We included it to assess whether local resistance patterns (particularly in urinary isolates) might justify its restricted use, reinforcing current guidelines. Its inclusion also serves as a negative control to highlight antibiotics that should not be empirically prescribed for S. aureus infections. Amikacin, an aminoglycoside, was selected because it retains activity against some methicillin-resistant S. aureus (MRSA) strains and is used in combination therapies for severe infections. In our region, aminoglycoside resistance patterns are underreported, and testing Amikacin helps identify potential salvage therapy options for multidrug-resistant (MDR) isolates. Both antibiotics had breakpoints of ≥17 mm considered susceptible, 15 – 16 mm Intermediate and ≤14 mm considered resistant. All presumptive isolates were subsequently inoculated in 1 ml of nutrient broth in a sterile Eppendorf tubes, vortexed and incubated overnight at 37˚C. the Eppendorf tubes were centrifuged at 8000 g for few minutes and 0.7 ml of the supernatant was discarded and 0.7 ml of 50% glycerol was added to the sediment, vortexed for 10 seconds and stored at −20˚C; awaiting molecular analysis. Sterility Testing: A plate from each media batch was incubated without inoculation to confirm absence of contamination. Growth Consistency: Each sample was inoculated onto two plates of the same media to verify reproducibility of microbial growth.

3.2. Molecular Screening of Presumptive Clinical S. aureus Isolates and Determination of Drug Resistant Traits

Presumptive clinical isolates of S. aureus were thawed and sub-cultured in nutrient agar at 37˚C for 18 – 24 hours. The extraction of bacteria DNA was done with the help of a compliance bacteria based and compatible DNA extraction kit, according to the manufacturer’s instructions and stored at −20˚C, for PCR analysis [14]. The entire DNA extracted was confirmed using 1.5% agarose gel electrophoresis as previously described [15]. The DNA extracted from clinical isolates was used to determine the presence of S. aureus nuc gene (F: GCGATTGATGGTGATACGGTT R: AGCCAAGCCTTGACGAACTAA AGC) obtained from Inquaba Biotech [16]. The presence of nuc genes indicated that the presumptive bacteria isolates were actually S. aureus isolates. The nuc gene cycling conditions were as follows; 35 cycles of denaturation at 94˚C for 2 minutes, annealing step at 55˚C for 30 seconds, extension at 72˚C for 30 seconds and final extension at 72˚C for 10 minutes [16]. S. aureus DNA confirmed having nuc gene, were further investigated for the detection of S. aureus drug resistance variants (ermA, vanA, mecA, sul3, and ermC gene). The vanA gene (F: ATG AAT AGA ATA AAA GTT GC and R: TCA CCC CTT TAA CGC TAA TA) with 45 PCR cycles was summarized as follows; Initial denaturation at 98˚C for 2 minute, denaturation at 98˚C for 10 minutes, annealing at 50˚C for 60 seconds, extension at 72˚C for 1.5 minute and final extension at 72˚C for 10 minutes [17]. The mecA gene (F: TGGCTATCGTGTCACAATCG and R: CTGGAACTTGTTGAGCAGAG) with 30 PCR cycles as was summarized as follows; Initial denaturation at 94˚C for 5 minutes, denaturation at 94˚C for 30 seconds, annealing at 55˚C for 30 seconds, extension at 72˚C for 5 minute and final extension at 72˚C for 10 minutes [18]. The sul3 gene (F: TCAAAGCAAAATGATATGAGC and R: TTTCAAGGCATCTGATAAAGA) with 30 PCR cycles was summarized as follows; Initial denaturation at 94˚C for 4 minute, denaturation at 94˚C for 30 seconds, annealing at 55˚C for 30 seconds, extension at 72˚C for 1 minute and final extension at 72˚C for 7 minutes [19]. The ermA gene with primer sequences (F: AAGCGGTAAACCCCTCTGA and R: TTCGCAAATCCCTTCTCAAC) and ermC gene (F: AATCGTCAATTCCTGCATGT and R: TAATCGTGGAATACGGGTTTG); both had 30 PCR cycles summarized as follows; Initial denaturation at 94˚C for 3 minutes, denaturation 94˚C for 30 seconds, annealing at 55˚C for 30 seconds, extension at 72˚C for 30 seconds and final extension at 72˚C for 4 minutes [20]. All DNA amplicons were separated on 1.5% agarose gel electrophoresis in 1x Tris borate acetate EDTA (TAE) buffer (BioConcept Ltd., Basel, Switzerland) along with a 1 kb DNA ladder (Solis Biodyne) and visualized by ethidium bromide staining under UV transilluminator imaging system (BIO-RAD, USA). Band sizes were as follows; vanA gene (1032 bp), ermA (190 bp), mecA (309 bp), sul3 (787 bp) and ermC (299 bp). Sterile nuclease-free water was included as a no-template control (NTC) in every run to rule out contamination. PCR results were considered valid only if the NTC showed no amplification.

3.3. Data Analysis

Data that was collected using well-structured questionnaires was cleaned and analyzed using Microsoft excel 2016 and the statistical software SPSS version 25. Demographic features of HIV positive and HIV negative participants was analyzed using descriptive statistics. The chi square statistical test was used to compare antimicrobial susceptibility profiles between HIV positive patients and HIV negative individuals. Binary logistic regression was used to determine the association of drug resistance variants and antibiotic susceptibility. The S. aureus bacteria isolates from the urine and nostrils of the same participants were compared using their antibiotic susceptibility profiles and the presence of identical drug resistance genes. Clinical isolates from the nostrils were considered putatively identical to those from urine; if they both had the same antimicrobial susceptibility profiles and identical drug resistance genes profiles. The chi square test was used to determine the whether the putatively identical S. aureus isolates were significantly associated with HIV positive patients and HIV negative participants. These comparisons may suggest relatedness but require additional genomic or high-resolution typing methods (whole-genome sequeng) to confirm clonality.

4. Results

4.1. Study Participants

At the beginning of the research, we met with 980 individuals, whereby 415 were HIV positive patients and 370 were HIV negative individuals (Figure 2). Of these, 370 HIV positive patients and 455 HIV negative individuals were examined potential participants; 155 potential eligible participants refused to be examined for eligibility. Amongst HIV positive and HIV negative participants examined, 257 and 282 people respectively were eligible for the study and 286 participants were excluded based on our inclusion and exclusion criteria. For the eligible participants, 252 HIV positive patients and 259 HIV negative individuals gave their informed consent to participate in the study, while 28 eligible participants refused to give their informed consent. The study included 250 HIV positive patients and 250 HIV negative individuals at the end because 09 participants were unable to give the required samples, they were excluded.

 

Figure 2. Flow chart showing the summary of study participants.

4.2. Sociodemographic Characteristics of the Study Participants

A total of 500 participants were recruited in this study, 250 were HIV positive patients and 250 HIV negative individuals as shown in Table 1. Majority 165/250 (66.0%) of HIV positive patients were females, as opposed to 158/250 (63.2%) females observed amongst HIV negative persons. Majority of the study participants were HIV patients within the age range of 41 – 50 years 110/250 (44.0%), who attained primary level of education 141/250 (56.4%) and were married 102/250 (40.8%). For the control group, most of participants were in the age range ≥ 51 years [78/250 (31.2%)], who attained secondary level of education [90/250 (36.0%)], were married persons [122/250 (48.8%)] and involved in business [124/250 (49.6%)].

Table 1. Socio-demographic properties of the study participants.

Variables	HIV Positive		HIV Negative
	Frequency	Percentage (%)	Frequency	Percentage (%)
Gender
Female	165	66.0	158	63.2
Male	85	34.0	92	36.8
Total	250	100.0	250	100.0
Age Range
≤30	7	2.8	57	22.8
31 – 40	44	17.6	53	21.2
41 – 50	110	44.0	62	24.8
≥51	89	35.6	78	31.2
Total	250	100.0	250	100.0
Educational status
Informal	10	4.0	6	2.4
Primary	141	56.4	88	35.2
Secondary	89	35.6	90	36.0
Tertiary	10	4.0	66	26.4
Total	250	100.0	250	100.0
Occupation
Employed	101	40.4	85	34.0
Unemployed	8	3.2	11	4.4
Business	134	53.6	124	49.6
Student	2	0.8	25	10.0
Retired	5	2.0	5	2.0
Total	250	100.0	250	100.0
Marital status
Single	65	26.0	84	33.6
Married	102	40.8	122	48.8
Widow/Widower	57	22.8	32	12.8
Divorced	26	10.4	12	4.8
Total	250	100.0	250	100.0

4.3. General Prevalence of MRSA and MSSA by mecA Gene Detection in the Study Population

As indicated in Figure 3, majority of S. aureus bacteria isolates detected in the study population where Methicillin susceptible [356/500 (71.2%)] and fewer bacteria detected were Methicillin Resistant Staphylococcus aureus [144/500 (28.8%)] isolates.

 

Figure 3. Prevalence of MRSA and MSSA isolates in HIV and Non-HIV participants.

4.4. Prevalence of MRSA and MSSA by mecA Gene Detection in HIV Positive and HIV Negative Individuals

Methicillin resistant Staphylococcus aureus was twice higher 97/500 (19.4%) in HIV positive patients as compared to the 47/500 (9.4%) detected in HIV negative participants. More [203/500 (40.6%)] HIV negative persons had Methicillin susceptible Staphylococcus aureus as opposed to 153/500 (30.6%) observed in HIV positive patients as indicated in Table 2.

Table 2. Distribution of MRSA and MSSA isolates in the study population.

Variables	HIV	Non-HIV	Total	P. Value (P ≤ 0.05)
	Frequency (%)	Frequency (%)
MRSA	97 (19.4)	47 (9.4)	144 (28.8)	0.0001
MSSA	153 (30.6)	203 (40.6)	356 (71.2)
Total	250 (50.0)	250 (50.0)	500 (100.0)

4.5. Antimicrobial Susceptibility Testing of Urogenital S. aureus Clinical Isolates from Clinical Samples

Table 3(a) and Table 3(b) shows that S. aureus isolates in HIV positive patients [106/403 (26.3)], were less susceptible (P = 0.0001) to Amikacin compared to HIV negative participants [213/403 (52.9%). Nitrofurantoin showed great bacteria clearance in both HIV positive patients [102/403 (25.2%)] and HIV negative individuals 214/403 (53.1%), where all bacteria isolates were susceptible (P = 0.0001). Moderate (P = 0.0001) sensitivity to Vancomycin was seen in HIV positive patients [78/403 (19.4%)] compared to 212/214 (52.6%) seen amongst HIV negative participants. Ciprofloxacin recorded the highest (P = 0.0001) degree of antimicrobial resistance in HIV positive patients [159/403 (39.5%)] compared to 166/403 (41.2%) seen in HIV negative participants. Resistance to Augmentin was observed to be higher (P = 0.0001) in isolates from HIV patients [148/403 (36.7%0] than HIV negative participants [165/403 (40.9%)]. Cephalosporins; Ceftriaxone had huge resistance in HIV positive patients [133/403 (33.0%)], which was lower (P = 0.0001) than HIV negative individuals 214/403 (53.1%), where all clinical isolates resisted all antibiotics which were tested. Resistance to Bactrim, that is routinely used as prophylaxis in HIV patients was lower (P = 0.0001) in HIV positive patients (135/403 (33.5%) than 165/403 (40.9%) observed in HIV negative individuals.

Table 3. (a) Antibiotic susceptibility profiles of urogenital S. aureus in HIV positive and HIV negative patients; (b) Antibiotic susceptibility profiles of urogenital S. aureus in HIV positive and HIV negative patients.

(a)
Antibiotics	Susceptibility	Group n (%)			P. Value (P ≤ 0.05)
		HIV	Non-HIV	Total
Augmentin	S	25 (6.2)	49 (12.2)	74 (18.4)	0.0001
	I	16 (4.0)	0 (0.0)	16 (4.0)
	R	148 (36.7)	165 (40.9)	313 (77.7)
	Total	189 (46.9)	214 (53.1)	403 (100.0)
Ceftriaxone	S	39 (9.7)	0 (0.0)	39 (9.7)	0.0001
	I	17 (4.2)	0 (0.0)	17 (4.2)
	R	133 (33.0)	214 (53.1)	347 (86.1)
	Total	189 (46.9)	214 (53.1)	403 (100.0)
Amikacin	S	106 (26.3)	213 (52.9)	319 (79.2)	0.0001
	I	24 (6.0)	0 (0.0)	24 (6.0)
	R	59 (14.6)	1 (0.2)	60 (14.9)
	Total	189 (46.9)	214 (53.1)	403 (100.0)
Ciprofloxacin	S	17 (4.2)	0 (0.0)	17 (4.2)	0.0001
	I	13 (3.2)	48 (11.9)	61 (15.1)
	R	159 (39.5)	166 ( (41.2)	325 (80.67)
	Total	189 (46.9)	214 (53.1)	403 (100.0)
Erythromycin	S	38 (9.4)	0 (0.0)	38 (9.4)	0.0001
	I	11 (2.7)	48 (11.9)	59 (14.7)
	R	140 (34.7)	166 (41.2	306 (75.9)
	Total	189 (46.9)	214 (53.1)	403 (100.0)
(b)
Clindamycin	S	64 (15.9)	163 (40.4)	227 (56.3)	0.0001
	I	20 (5.0)	11 (2.7)	31 (7.7)
	R	105 (26.1)	40 (9.9)	145 (36.0)
	Total	189 (46.9)	214 (53.1)	403 (100.0)
Chloramphenicol	S	41 (10.2)	0 (0.0)	41 (10.2)	0.0001
	I	20 (5.0)	11 (2.7)	31 (7.7)
	R	128 (31.8)	203 (50.4)	331 (82.1)
	Total	189 (46.9)	214 (53.1)	403 (20.0)
Bactrim	S	30 (7.4)	37 (9.2)	67 (16.7)	0.045
	I	24 (6.0)	12 (3.0)	36 (8.9)
	R	135 (33.5)	165 (40.9)	300 (74.4)
	Total	189 (46.9)	214 (53.1)	403 (100.0)
Vancomycin	S	78 (19.4)	212 (52.6)	290 (72.0)	0.0001
	I	13 (3.2)	0 (0.0)	13 (3.2)
	R	98 (24.3)	2 (0.5)	100 (24.8)
	Total	189 (46.9)	214 (53.1)	403 (100.0)
Nitrofurantoin	S	102 (25.2)	214 (53.1)	316 (78.4)
	I	18 (4.5)	0 (0.0)	18 (4.5)	0.0001
	R	69 (17.1)	0 (0.0)	69 (17.1)
	Total	189 (46.9)	214 (53.1)	403 (100.0)

S = Sensitive I = Intermediate R = Resistant.

4.6. Antimicrobial Susceptibility Testing of Nasal Carriage S. aureus Clinical Isolates from Clinical Samples

Nasal carriage S. aureus clinical isolates were more sensitive to commonly used antibiotics. S. aureus clinical isolates from HIV positive patients were ironically more sensitive to tested antibiotics, compared to those from the control group (Table 4). The sensitivity patterns of 167 S. aureus isolates were observed between HIV positive and HIV negative participants as follows; Clindamycin [77 (46.1)] vs 30 (18.0%) P = 0.0001], Chloramphenicol [70 (41.9%) vs 36 (21.6%) P = 0.004] and Amikacin [65 (38.9%) vs 60 (35.9%) P = 0.0001. Resistance to some of the tested antibiotics between HIV positive and HIV negative was seen as follows; Amoxicillin [84 (50.3%) vs 65 (38.9%) P = 0.024] and Ciprofloxacin [70 (41.9%) vs 58 (34.7%) P = 0.013].

4.7. Multiple Antibiotic Resistance Indices

Multiple antibiotic resistance indices of antibiotics used in the treatment of urogenital S. aureus observed in the study population were high; in both HIV positive and HIV negative participants. S. aureus MAR index in HIV positive patients was 0.9 and in HIV negative participants, it was 0.7. The MAR index of antibiotics used in the treatment of nasal carriage S. aureus in HIV positive and HIV negative persons was the same (0.4) as seen in Table 5.

Table 4. Antibiotic susceptibility profiles of nasal carriage S. aureus in HIV and Non-HIV.

Antibiotics	Susceptibility	Group n (%)			P. Value (P ≤ 0.05)
		HIV Positive	HIV Negative	Total
Amoxicillin	S	11 (6.6)	2 (1.2)	13 97.8)
	I	5 (3.0)	0 (0.0)	5 (3.0)	0.024
	R	84 (50.3)	65 (38.9)	149 (89.2)
	Total	100 (59.9)	67 (40.1)	167 (100.0)
Amikacin	S	65 (38.9)	60 (35.9)	125 (74.5)
	I	29 (17.4)	0 (0.0)	29 (17.4)	0.0001
	R	6 (3.6)	7 (4.2)	13 (7.8)
	Total	100 (59.9)	67 (40.1)	167 (100.0)
Ciprofloxacin	S	30 (18.0)	9 (5.4)	39 (23.4)
	I	0 (0.0)	0 (0.0)	0 (0.0)	0.013
	R	70 (41.9)	58 (34.7)	128 (76.6)
	Total	100 (59.9)	67 (40.1)	167 (100.0)
Erythromycin	S	30 (18.0)	14 (8.4)	44 (26.3)
	I	1 (0.6)	12 (7.2)	13 (7.8)	0.0001
	R	69 (41.3)	41 (24.6)	110 (65.9)
	Total	100 (59.9)	67 (40.1)	167 (100.0)
Clindamycin	S	77 (46.1)	30 (18.0)	107 (64.1)
	I	1 (0.6)	16 (9.6)	17 (10.2)	0.0001
	R	22 (13.2)	21 (12.6)	43 (25.7)
	Total	100 (59.9)	67 (40.1)	167 (100.0)
Chloramphenicol	S	70 (41.9)	36 (21.6)	106 (63.5)
	I	0 (0.0)	6 (3.6)	6 (3.6)	0.004
	R	30 (18.0)	25 (15.0)	55 (32.9)
	Total	100 (59.9)	67 (40.1)	167 (100.0)

Table 5. Multiple antibiotic resistance index of S. aureus and E. coli isolates.

Isolates	HIV		Non-HIV	MAR Index
	Resistant Antibiotics (a)	MAR Index	Resistant Antibiotics (a)
Urogenital S. aureus	17	0.9	14	0.7
Nasal S. aureus	8	0.4	8	0.4

MAR Index = a/b, Where b (Total number of antibiotics tested) = 18.

4.8. General Prevalence of Drug Resistance Genes of S. aureus Isolates in HIV Positive and HIV Negative Persons

In this study, five virulence genes (vanA, ermA, mecA, sul3 and ermC) of S. aureus were investigated. The overall prevalence of vanA gene 154/500 (30.8%) predominated all other genes. The ermA, mecA, sul3 and ermC genes occurred as follows; 148/500 (29.6%), 143/500 (28.6%), 108/500 (21.6%) and 90/500 (18.0%) respectively in the study population (Figures 4–7).

 

Figure 4. Overall prevalence of drug resistance genes in HIV positive and HIV negative persons.

 

Figure 5. Electrophoresis gel showing ermC gene.

 

Figure 6. Electrophoresis gel showing mecA gene.

 

Figure 7. Electrophoresis gel showing sul3 gene.

4.9. Association of Drug Resistance Genes and Antibiotic Susceptibility

Drug resistance genes were observed to be significantly associated to S. aureus resistance to commonly prescribed antibiotics (Table 6). The Macrolide gene (ermA) was strongly associated (P = 0.032) to resistance to Chloramphenicol [102/171 (59.6%)]. The Sulfonamide gene (sul3) was associated to the following antibiotics; Levofloxacin [66/171 (38.6%), P = 0.029], Ciprofloxacin [72/171 (42.1%), P = 0.029], Bactrim [60/171 (35.1%), P = 0.008] and Augmentin [68/171 (39.8%), P = 0.0001].

Table 6. Association between drug resistance genes and antibiotic resistance.

Antibiotics	Characteristics	Drug resistance gene n (%) n = 171			P. Value (P ≤ 0.05)
		Present	Absent	Total
ermA gene
Chloramphenicol	Sensitive	25 (14.6)	1 (0.6)	26 (15.1)	0.032
	Intermediate	11 (6.4)	6 (3.5)	17 (9.9)
	Resistant	102 (59.6)	26 (15.2)	128 (74.9
Sul3 gene
Levofloxacin	Sensitive	12 (7.0)	11 (6.4)	23 (13.5)	0.029
	Intermediate	20 (11.7)	27 (15.8)	47 (27.5)
	Resistant	66 (38.6)	35 (20.5)	101 (59.1)
Ciprofloxacin	Sensitive	7 (4.1)	6 (3.5)	13 (7.6)	0.029
	Intermediate	6 (3.5)	27 (15.8)	46 (26.9)
	Resistant	72 (42.1)	40 (23.4)	112 (65.5)
Bactrim	Sensitive	24 (14.0)	34 (19.9)	58 (33.9)	0.008
	Intermediate	14 (8.2)	5 (2.9)	19 (11.1)
	Resistant	60 (35.1)	34 (19.9)	94 (55.0)

4.10. Genotypic Similarities of Bacteria Isolates

Our findings indicated that 15/79 (19.0%) of HIV positive patients had S. aureus clinical isolates in their urine and nasal samples, which were identical to each other and 30/79 (38.0%) of the clinical isolates were not identical. These findings were significantly not different (P = 0.135) from what was observed amongst HIV negative participants; where the S. aureus clinical isolates were equally distributed as identical isolates [17/79 (21.5%)] and non-identical isolates [17/79 (21.5%)], Table 7.

Table 7. Molecular similarity of S. aureus clinical isolates between HIV positive and HIV negative patients.

Identity status	HIV Positive n (%)	HIV Negative n (%)	Total n (%)	P. Value (P ≤ 0.05)
Identical	15 (19.0)	17 (21.5)	32 (40.5)
Non-identical	30 (38.0)	17 (21.5)	47 (59.5)	0.135
Total	45 (47.0)	34 (43.0)	79 (100.0)

5. Discussion

The prevalence of MRSA based on mecA detection by PCR was 28.8%; whereby 19.4% was detected amongst HIV positive patients and 9.4% detected amongst HIV negative individuals. Sub-group profiling of urogenital and nasal carriage bacteria showed that S. aureus clinical isolates, which were detected both in the urine and in nostrils of HIV positive population, were not identical to each other. The difference in the similarity of isolates amongst HIV positive patients (19.0%) and HIV negative individuals (21.5%) was not significant (P = 0.135). Drug resistance genes investigated in this study were distributed as follows; vanA (30.8%), ermA (29.6%), mecA (28.6%), sul3 (21.6%) and ermC (18.0%). Urogenital S. aureus clinical isolates were resistant to locally prescribed antimicrobial agents. Resistance was observed to be higher in HIV negative individuals and HIV positive patients. Resistance against Cephalosporins was severe, while Aminoglycosides showed great clearance of bacteria isolates.